View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_high_92 (Length: 214)
Name: NF17452_high_92
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_high_92 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 14104 - 13926
Alignment:
| Q |
16 |
atgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcggcagaaggtatgggaaatagtcgcagcaggccattttgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14104 |
atgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcagcagaaggtatgggaaatagtcgcagcagaccattttgaa |
14005 |
T |
 |
| Q |
116 |
tcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14004 |
tcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagat |
13926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 168
Target Start/End: Original strand, 43010780 - 43010827
Alignment:
| Q |
121 |
tctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatgg |
168 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
43010780 |
tctctgatgatgtgacaatctatttcaacgtgtttaatacgttcatgg |
43010827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University