View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_low_46 (Length: 353)
Name: NF17452_low_46
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_low_46 |
 | |
|
| [»] scaffold0194 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0194 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 15 - 344
Target Start/End: Original strand, 29086 - 29416
Alignment:
| Q |
15 |
agttagacatataaaaaacagaccacactaaaaatattatgtatcaccttactagtatagattattttcgatccatgatgcatatggacctatttattaa |
114 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29086 |
agttagacatataaaaaacagacaacactaaaaatattatgtatcaccttactagtatagatgattttcgatccatcatgcatatggacctatttattaa |
29185 |
T |
|
| Q |
115 |
nnnnnnnaaaccatcatatacattgcattggccatgtttgatatttatcttattttcatgcactcactcgctc--catcactcgtgggaaataaggccaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29186 |
atttttttaaccatcatatacattgcattggccatgtttgatatttatcttattttcatgcactcactcgctctccatcactcgtgggaaataaggccaa |
29285 |
T |
|
| Q |
213 |
tggtagaatatataagagacaaaatcttcaattttgtttccatcagattcagaacataaattagtttacaagtacatatgactttgatgctcaaagtcaa |
312 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29286 |
tggtagaatgtataagagacaaaatcttcaattt-gtttccatcagattcagaacataaattagtttacaagtacatatgactttgatgctcaaagtcaa |
29384 |
T |
|
| Q |
313 |
cgtgtcccgtaccatcgttggtgtgccctttg |
344 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
29385 |
cgtgtaccgtaccatcgttggtgtgccctttg |
29416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University