View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_low_49 (Length: 333)
Name: NF17452_low_49
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 138 - 323
Target Start/End: Complemental strand, 408801 - 408616
Alignment:
| Q |
138 |
tttgaaactatccctaaagtttcaactcttcaaaaagttacaaagagtttgggaaaatttacgtctattacataaaaagttataaagtatcattaagaag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408801 |
tttgaaactatccctaaagtttcaactcttcaaaaagttacaaagagtttgagaaaatttacgtctattacataaaaagttataaagtatcattaagaag |
408702 |
T |
 |
| Q |
238 |
ttacaagatgaaggcaagtgtgacactggttttcatccaaatttcccaaaatttgctggccctcttaatctgatcacacatctgtg |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408701 |
ttacaagatgaaggcaagtgtgacactggttttcatccaaatttcccaaaatttgctggccctcttaatctgatcacacatctgtg |
408616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 50 - 136
Target Start/End: Complemental strand, 412959 - 412871
Alignment:
| Q |
50 |
acatacatgtaaagaaaacagataaaaagct--agatagatacagaacattatagaacaagggtttgtatacaaacatcttaaatttag |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
412959 |
acatacatgtaaagaaaacagataaaaagctttagatagatacagaacattatagaacaagggtttgtatacaaacatcttaaatttag |
412871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 413020 - 412982
Alignment:
| Q |
1 |
cctccctatcattaaagagaataagaaagaagcttttaa |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
413020 |
cctccctatcattaaagagaataagaaagaagcttttaa |
412982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 3 - 39
Target Start/End: Original strand, 11655797 - 11655833
Alignment:
| Q |
3 |
tccctatcattaaagagaataagaaagaagcttttaa |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11655797 |
tccctatcattaaagagaataagaaagaagcttttaa |
11655833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University