View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_low_55 (Length: 309)
Name: NF17452_low_55
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_low_55 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 18 - 292
Target Start/End: Original strand, 134412 - 134686
Alignment:
| Q |
18 |
ccacccatcactgccttcttaattcggcccaacaccgacaatattaactttcaattcattattgacaacttcttcttctcatgcaaacaaccatatcctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
134412 |
ccacccatcactgccttcttaattcggcccaacaccgacaatattaactttcaattcattattgacaacttcttcttctcatgcaaacaaccatatcctc |
134511 |
T |
 |
| Q |
118 |
cgtgctggtgctggcctctttaacaacactaactgaaaacaatctaagaaagatagatatccttcagaggaaaccaaaccaaccaacccaccactaataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
134512 |
cgtgctggtgctggcctctttaacaacactaactgaaaacaatctaagaaagatagatatccttcagaggaaaccaaaccaaccaacccaccactaataa |
134611 |
T |
 |
| Q |
218 |
atagtgcccctagtctctcctactaagtgaaaggtcttttggcactacgttagaagaaaaagagatacacaatta |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
134612 |
atagtgcccctagtctctcctactaagtgaaaggtcttttggcactacgttagaagaaaaagagatacacaatta |
134686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University