View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_low_64 (Length: 286)
Name: NF17452_low_64
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_low_64 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 49656087 - 49656317
Alignment:
| Q |
7 |
atcagtgccgtgtttgattgctgtttctcaggaatacctcgtttggaagaattaaataatcnnnnnnnn-ataatcacattataaaattgagattaaaat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49656087 |
atcagtgccgtgtttgattgctgtttctcaggaatacctcgtttgtaagaattaaataatctttttttttataatcacattataaaattgagattaaaat |
49656186 |
T |
 |
| Q |
106 |
aatcagattatttagtactttacacagtaaaacatatatttcttcagaattaaagttggatacaacact-----tgtactatatattatgaattgctatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
49656187 |
aatcagattatttagtactttacacagtaaaacagatatttcttcagaattaaagttggatacaacacttgcactgcactatatattatgaattgctatt |
49656286 |
T |
 |
| Q |
201 |
actacaaaatttggtagccattgtttagtat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
49656287 |
actacaaaatttggtagccattgtttagtat |
49656317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 251 - 283
Target Start/End: Original strand, 49656322 - 49656354
Alignment:
| Q |
251 |
atatatatacggtattttgtttatcctgattct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
49656322 |
atatatatacggtattttgtttatcctgattct |
49656354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University