View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_low_69 (Length: 264)
Name: NF17452_low_69
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_low_69 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 35 - 264
Target Start/End: Original strand, 657808 - 658037
Alignment:
| Q |
35 |
ccacaacagccatcatgtctttcattaaccttccactgtcttcgtcttttatggaagtattataaccaaggttgagcggggttacctcattcaaatacgc |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
657808 |
ccacaacagccatcatgtctttcattaaccttccactgttttcgtcttttatgaaagtattataaccaaggttgagcgaggttacctcattcaaatacgc |
657907 |
T |
|
| Q |
135 |
agttggaacattctgatcaccatttaatactccagcatagtatacagcaccatgtgctacgaccacatcggggtaaatagtcttcaaaatctgcttgcct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
657908 |
agttggaacattctgatcaccatttaatactgcagcatagtatacagcaccatgtgctacggccacatcggggtaaatggtcttcaaaatctgcttgcct |
658007 |
T |
|
| Q |
235 |
ttaaataatttcgtcaaaagtgattcaatc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
658008 |
ttaaataatttcgtcaaaagtgattcaatc |
658037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University