View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_low_84 (Length: 238)
Name: NF17452_low_84
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_low_84 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 19 - 131
Target Start/End: Complemental strand, 48596620 - 48596508
Alignment:
| Q |
19 |
cggtggttgttgatggtggcgtaattggcgaggaggtgagataatagaggggattcatgttgttgttattattaacaagcaggtgatcagcagcaggagc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48596620 |
cggtggttgttgatggtggcgtaattggcgaggaggtgagataatagaggggattcatgttgttattattatcaacaagcaggtgatcagcagcaggagc |
48596521 |
T |
 |
| Q |
119 |
agggtggtggtac |
131 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48596520 |
agggtggtggtac |
48596508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 48596477 - 48596421
Alignment:
| Q |
165 |
gtagtagtggtagtagtagtatagaaattggtgttgtaatattgagggtgagatatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48596477 |
gtagtagtggtagtagtagtatagaaattggtgttgtaatattgagggtgagatatt |
48596421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University