View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17452_low_88 (Length: 230)
Name: NF17452_low_88
Description: NF17452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17452_low_88 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 177
Target Start/End: Original strand, 29603710 - 29603879
Alignment:
| Q |
18 |
catgcaaggttttcaaaaaagggatacacaaccacagtttaggttgcaaaatgaaggaatttcgtgtctgagactgcaacatgaccacaattgagatcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29603710 |
catgcaaggttttcaaaaaagggatacacaaccacagtttaggttgcaaaatgaaggaatttcgtgtctgagactgcaacatgaccacaattgagattat |
29603809 |
T |
|
| Q |
118 |
atcagcggcacttgagct----------caatataaaagatcgcaacatgaatttgatttacaacttagt |
177 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29603810 |
atcagcggcacttgagctcaattgtacacaatataaaagatcgcaacatgaatttgatttacaacttagt |
29603879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 47 - 132
Target Start/End: Complemental strand, 29602626 - 29602539
Alignment:
| Q |
47 |
aaccacagtttaggttgcaaaatgaaggaatttcgtgtc--tgagactgcaacatgaccacaattgagatcatatcagcggcacttga |
132 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||| |||| || ||||||||||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
29602626 |
aaccacaacttaggttccaaaatcaaggaatttcatgtcgctgcgactgcaacatgaccacaagtgagatcatatgagcggcatttga |
29602539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 175 - 216
Target Start/End: Original strand, 29605217 - 29605258
Alignment:
| Q |
175 |
agtgtgagttagtaatcggttacagttagagttacttatgaa |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
29605217 |
agtgtgagttagtaatcggttacggttagagttacttgtgaa |
29605258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University