View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17453_high_14 (Length: 327)
Name: NF17453_high_14
Description: NF17453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17453_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 38 - 313
Target Start/End: Original strand, 23040734 - 23041009
Alignment:
| Q |
38 |
gaatttcaagaacaagacaagggtaatagtagaaggatcaaaaaatgaagga-----agagagcaagaatcttcaagcagtggaagtggtttatcatcag |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |||||| | | ||||| || ||||||||||||||||||||||||||| |
|
|
| T |
23040734 |
gaatttcaagaacaagacaagggtaatagtagatggatcaaaacatgaagaatcttcaaggagca-----ctacaagcagtggaagtggtttatcatcag |
23040828 |
T |
 |
| Q |
133 |
aggattgttcaagaatggtaacaataaaaaatgaggtgagtaataatggtggtttttgggggttggatctaacaatggataaagtcaaagaagaagtagg |
232 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23040829 |
aggattgttcaagaatgataagaataaaaaatgaggtgagtaataatggtggtttttgggggttggatctaacaatggataaagtcaaagaagaagtagg |
23040928 |
T |
 |
| Q |
233 |
tggtgatgagagatgtggtgggtacttaggtgggttttcagatttggaagggtttatttctgaaattaatggtggatttcc |
313 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23040929 |
ttgtgatgagagatgtggtgggtacttaggtgggttttcagatttggaagggtttatttctgaaattaatggtggatttcc |
23041009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University