View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17453_high_27 (Length: 257)
Name: NF17453_high_27
Description: NF17453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17453_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 515824 - 515594
Alignment:
| Q |
11 |
caagaatatcatacgaaatgaaaactccattacaattttcagctgacggagggagagcctcaggttcttgacattcacacacatacacattgtatgaaat |
110 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
515824 |
caagaaaatcatacgaaatgaaaactccattacaattttcagctgacggagggagagcctcaggttcttgacattcacacacatagacattgtatgaaat |
515725 |
T |
 |
| Q |
111 |
caacaatgttgctaatgataacaattgacatatccatttgtttgacatgtcttattattattctattgtcaatctctctcgcatttgcatgatggaatat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
515724 |
caacaatgttgctaatgataacaattgacatatccatttgtttgacatgtcttattattatcctattgtcaatctctctcgcatttgcatgatggaatat |
515625 |
T |
 |
| Q |
211 |
gagaaattgttgtaatgatcgagcttctaga |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
515624 |
gagaaattgttgtaatgatcgagcttctaga |
515594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University