View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17453_high_3 (Length: 488)
Name: NF17453_high_3
Description: NF17453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17453_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 8e-90; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 8e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 12184063 - 12184301
Alignment:
| Q |
1 |
aacaacttgtgaatttgaaagtctagggtctaataaaatgagacctnnnnnnntacagtgatacatttagtataatatacgtaattaataaagtatgcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12184063 |
aacaacttgtgaatttgaaagtctagggtctaataaaatgagacctaaaaaa-tacagtgatccatttagtataatatacgtaattaataaagtatgcga |
12184161 |
T |
 |
| Q |
101 |
ctgcatgtgttagttgggtttcttttttaaacggcatgaacttc-nnnnnnnnnnaggggaaacgggcatgaacttttgtggtaaatatgatcaaatcaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12184162 |
ctgcatgtgttagttgggtttcttttttaaacggcatgaacttctttttttttttaggggaaacgggcatgaacttttgtggtaaatatgatcaaatcaa |
12184261 |
T |
 |
| Q |
200 |
atattgaacatatatgatcctttttattactcttgaacct |
239 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12184262 |
atattaaacatatatgatcctttttattactcttgaacct |
12184301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 300 - 466
Target Start/End: Original strand, 12184362 - 12184528
Alignment:
| Q |
300 |
gatcacagtaagtactcnnnnnnnacagaaagaccgtaagtactatagttttagaatgcaatcagaaagtaagcaagtacgaacagtactaagaggccgg |
399 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12184362 |
gatcacagtaagtactctttttttacagaaagaccgtaagtactatagttttagaatgcaatcagaaagtaagcaagtacgaacagtactaagacgccgg |
12184461 |
T |
 |
| Q |
400 |
tggtaatgacataggtttttgctactacttagagcatcttcaatggagtccttatttaacaacgacc |
466 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
12184462 |
tggtaatgacataggtttttgctactacttagagcatcttcaatggggtccttatttaacaaggacc |
12184528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 430 - 467
Target Start/End: Original strand, 39446103 - 39446140
Alignment:
| Q |
430 |
agagcatcttcaatggagtccttatttaacaacgacca |
467 |
Q |
| |
|
||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
39446103 |
agagcattttcaatggagtccttatttaacaaggacca |
39446140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University