View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17453_high_32 (Length: 222)
Name: NF17453_high_32
Description: NF17453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17453_high_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 36323350 - 36323558
Alignment:
| Q |
1 |
ctatttaaaacttatcaattacaagtaatgtaatgaagtctatatattgtgaattatgttgcagggactggcgttactcacggtacaagcacattaccct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36323350 |
ctatttaaaacttatcaattacaagtaatgtaatgaagtctatatattgtgaattatgttgcagggactggcgttactcacagtacaagcacattaccct |
36323449 |
T |
 |
| Q |
101 |
aacctaaaaccagccatatgcaacctctatgacaaaaatgcagtgtgtgaaaaaattagtggcaaccatgaagcttttctcttgattggtctctacttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36323450 |
aacctaaaaccagccatatgcaacctctatgacaaaaatgcagtgtgtgaaaaaattagtggcaaccatgaagcttttctcttgattggtctctacttgt |
36323549 |
T |
 |
| Q |
201 |
tggcctttg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
36323550 |
tggcctttg |
36323558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 45 - 209
Target Start/End: Original strand, 36330240 - 36330404
Alignment:
| Q |
45 |
tattgtgaattatgttgcagggactggcgttactcacggtacaagcacattaccctaacctaaaaccagccatatgcaacctctatgacaaaaatgcagt |
144 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
36330240 |
tattgtgaactatgctgcagggactggcgttactcacagtacaagcacattaccctaatctgaaaccagccatatgcaacttacttgacaaaaatgcagt |
36330339 |
T |
 |
| Q |
145 |
gtgtgaaaaaattagtggcaaccatgaagcttttctcttgattggtctctacttgttggcctttg |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
36330340 |
gtgtgaaaaaattaatggcaaccatgaagcttttctcttcattagtctatacttgttggcctttg |
36330404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 133 - 209
Target Start/End: Original strand, 37919830 - 37919906
Alignment:
| Q |
133 |
caaaaatgcagtgtgtgaaaaaattagtggcaaccatgaagcttttctcttgattggtctctacttgttggcctttg |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||| ||| |||||||||||| |
|
|
| T |
37919830 |
caaaaatgcagtgcgtgaaaaaattagtggcaaccatgaagcttttctcttcattagtctatacgtgttggcctttg |
37919906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University