View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17453_low_13 (Length: 332)
Name: NF17453_low_13
Description: NF17453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17453_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 302
Target Start/End: Complemental strand, 10692146 - 10691859
Alignment:
| Q |
20 |
gaactctctggtcttgcttagttgaggttgttgaggtgagacagcaaaacacacaacacgaagcaaagaaggtattcacgattcggtattggtcggtttg |
119 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10692146 |
gaactctctggtcttggttagttgaggttgttgaggtgagacagcaaaacacacaacacgaagcaaagaaggtattcacgattcggtattggtcggtttg |
10692047 |
T |
|
| Q |
120 |
taagtatgtttgctttggtcgttggctgcgtgcgtgtgttgggctaatgttccaccttctttcaaagtggaatatatacgcaatggcttatgccaacg-- |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
10692046 |
taaatatgtttgctttggtcgttggctgcgtgcgtgtgttggactaatgttccaccttctttcaaagtggaatatatatggaatggcttatgccaacgaa |
10691947 |
T |
|
| Q |
218 |
-----atcaaatttgtccttgaatttacaaaagaccaatcaaattcatcccccaannnnnnnaaatatcaagttagtccattaatttaac |
302 |
Q |
| |
|
|||| ||| |||||||||||||| ||||| ||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
10691946 |
taatcatcacattcgtccttgaatttac-aaagaacaatcaaattcat-ccccaaattttttaaatatcaagttagtccattaatttaac |
10691859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University