View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17453_low_31 (Length: 254)
Name: NF17453_low_31
Description: NF17453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17453_low_31 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 11 - 254
Target Start/End: Original strand, 4412448 - 4412691
Alignment:
| Q |
11 |
gatgaagggccgagattgtttatcgggtgaaaacatgtggttttccggatccgtagacatttcttaatccttgcttattttgagagaaactatttgccat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4412448 |
gatgaagggccgagattgtttatcgggtgaaaacatgtggttttccggatccgtagacatttcttaatccttgcttattttgagaggaactatttgccat |
4412547 |
T |
|
| Q |
111 |
taaaaatatagcccttatcatataaaagttatgaaacatattatttgttgttggttgtctaggtatcaaactggtttattaatgcgcgtgttcggctatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412548 |
taaaaatatagcccttatcatataaaagttatgaaacatattatttgttgttggttgtctaggtatcaaactggtttattaatgcgcgtgttcggctatg |
4412647 |
T |
|
| Q |
211 |
gaaaccattgattgaggaaatgtatgctgaaatgaatagaagaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412648 |
gaaaccattgattgaggaaatgtatgctgaaatgaatagaagaa |
4412691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 77 - 128
Target Start/End: Complemental strand, 126053 - 126002
Alignment:
| Q |
77 |
atccttgcttattttgagagaaactatttgccattaaaaatatagcccttat |
128 |
Q |
| |
|
||||||| |||||| ||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
126053 |
atccttgtttatttagagaggaactatttgccatgaaaaatgtagcccttat |
126002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University