View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17455_low_13 (Length: 338)
Name: NF17455_low_13
Description: NF17455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17455_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 42 - 135
Target Start/End: Original strand, 15284582 - 15284675
Alignment:
| Q |
42 |
ataggtagtggtacaaaccctataccgttacttcaaccttttacaagtagttctatttgagaagaaactacaatctataaattcactttcacat |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15284582 |
ataggtagtggtacaaaccctataccgttacttcaaccttttacaagtagttctatttgagaagaaactacaatctataaattcactttcacat |
15284675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 241 - 319
Target Start/End: Original strand, 15284781 - 15284859
Alignment:
| Q |
241 |
taaccatggtgtttagggttatccaacaattatgagaatgcagnnnnnnnggaactaaacaattataaaggaaaacatg |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
15284781 |
taaccatggtgtttagggttatccaacaattatgagaatgcagtttttttggaacggaacaattataaaggaaaacatg |
15284859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University