View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17455_low_17 (Length: 268)
Name: NF17455_low_17
Description: NF17455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17455_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 36226095 - 36226333
Alignment:
| Q |
18 |
atcaccagattcaacagcttcatatgcttctttaacagattttattatgaacttgctgtctctatctacgagaaaatacttagtacattttaggttatag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36226095 |
atcaccagattcaacagcttcatatgcttctttaacagattttattatgaacttgctgtctctatctacgagaaaatacttagtacattttaggttatag |
36226194 |
T |
|
| Q |
118 |
aaattattccctccctcccataatcatggccaatttgttaaaaatatttgtcacaaaatgaaagacccttttaattttcagcataatattaacaacnnnn |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36226195 |
aaattattccctccctcccataatcatggccaatttgataaaaatatttgtcacaaaatgaaagacccttttaattttcagcataatattaacaactttt |
36226294 |
T |
|
| Q |
218 |
nnncaattgtactacttacatcactctcaattcaatatt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36226295 |
ttccaattgtactacttacatcactctcaattcaatatt |
36226333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 36234504 - 36234438
Alignment:
| Q |
18 |
atcaccagattcaacagcttcatatgcttctttaacagattttattatgaacttgctgtctctatct |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36234504 |
atcaccagattcaacagcttcatatgcttctttaacagattttattatgaacttgctgtctctatct |
36234438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 36250931 - 36250878
Alignment:
| Q |
18 |
atcaccagattcaacagcttcatatgcttctttaacagattttattatgaactt |
71 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||| ||||| |||| |||||||||| |
|
|
| T |
36250931 |
atcaccacattcaacacctttatatgcttcttcaacagcttttgttatgaactt |
36250878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 178
Target Start/End: Complemental strand, 36234384 - 36234344
Alignment:
| Q |
138 |
taatcatggccaatttgttaaaaatatttgtcacaaaatga |
178 |
Q |
| |
|
||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
36234384 |
taatcatcgccaatttataaaaaatatttgtcacaaaatga |
36234344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University