View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17455_low_18 (Length: 255)
Name: NF17455_low_18
Description: NF17455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17455_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 23 - 141
Target Start/End: Original strand, 35241482 - 35241602
Alignment:
| Q |
23 |
aaacatatatttgattcaaaataactttaaacattagagttgttttatttt--tcatttaatgtgtgcgattcctcaactgcatgatttcgtgttttcct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35241482 |
aaacatatatttgattcaaaataactttaaacattagagttgttttatttttttcatttaatgtgtgcgattcctcaactgcatgatttcgtgttttcct |
35241581 |
T |
|
| Q |
121 |
ccacgagagagaatctaaatc |
141 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
35241582 |
ccacgagagagaatctaaatc |
35241602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 136 - 243
Target Start/End: Original strand, 35241765 - 35241872
Alignment:
| Q |
136 |
taaatcatatcaattacttattggccctgtcagtatttaatacacgacattgtcaaatagatcttattgatggagttctttcatctaaatttaataagtt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35241765 |
taaatcatatcaattacttattggccctgtcagtatttaatacccgacattgtcaaatagatgttattgatggagttctttcatctaaatttaataagtt |
35241864 |
T |
|
| Q |
236 |
tcatctca |
243 |
Q |
| |
|
|||||||| |
|
|
| T |
35241865 |
tcatctca |
35241872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University