View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17455_low_20 (Length: 245)
Name: NF17455_low_20
Description: NF17455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17455_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 15284289 - 15284498
Alignment:
| Q |
13 |
aaaatagacaaagagaaagattcttaaaattccaccatctatcgttataagttaacaaaagaagagaactagactactacaggatgcattggtatgtgta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
15284289 |
aaaatagacaaagagaaagattcttaaaattccaccatctattgttataagttaacaaaagaagagatctagactactagatgatgcattggtatgtgta |
15284388 |
T |
 |
| Q |
113 |
caatagggatacaatatcgggta-caagtatccgtcgaatcaaagtcggatagggtataagaatcgggtaccaaggacgggtagtatcaaagttggatag |
211 |
Q |
| |
|
||||| |||||||| |||||||| || | | |||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||| || ||| |
|
|
| T |
15284389 |
caatacggatacaacatcgggtaccagggacgggtcgtatcaaagtcggatagggtataagaatcgggtaccacagacgggtagaatcaaagtcgggtag |
15284488 |
T |
 |
| Q |
212 |
ggtacatcag |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
15284489 |
ggtacatcag |
15284498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University