View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17455_low_22 (Length: 236)
Name: NF17455_low_22
Description: NF17455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17455_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 48410258 - 48410052
Alignment:
| Q |
1 |
actgatcagaccggcctgtcataatgcatttcccatcagttttgttggtaacctcgtcacattgcctatttctgcatttcacatcctcataggataagct |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48410258 |
actgatcagacctgcctgtcataatgcatttcccatcagttttgttggtaacctcgtcacattgcctatttctgcatttcacatcctcataggataagct |
48410159 |
T |
 |
| Q |
101 |
atgttgcagatattgcaaactttaattact-attcg------------ttaagttagtttttatatatttctgtttaatataaaattccgatgttaaatt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48410158 |
atgttgcagatattgcaaactttaattactgtttcgttaagttagtttttaagttagtttttatatatttctgtttaatataaaattctgatgttaaatt |
48410059 |
T |
 |
| Q |
188 |
ctgaatt |
194 |
Q |
| |
|
||||||| |
|
|
| T |
48410058 |
ctgaatt |
48410052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University