View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17457_high_5 (Length: 349)
Name: NF17457_high_5
Description: NF17457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17457_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 47635515 - 47635846
Alignment:
| Q |
1 |
tgactttatcaattagtattaaatagaggcaacaactgtaaataaccttaattaatgttgcattgaaaatcgaaggtattattacaattttaattttgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47635515 |
tgactttatcaattagtattaaatagaggcaacaactgtaaataaccttaattaatgttgcattgaaaatcgaaggtatcattacaattttaattttgca |
47635614 |
T |
 |
| Q |
101 |
ggaactagcgggatctcatcagggacaattgttgcaattgtggttccgatttctgtggccacgctgctattaatcgttggtgtttgtttcttaagtaaaa |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47635615 |
ggaagtagcgggatctcatcagggacaattgttgcaattgtggttccgatttctgtggccacactgctattaatcgttggtgtttgtttcttaagtaaaa |
47635714 |
T |
 |
| Q |
201 |
gagcatggaagaagaagcatgactctgcagcacaagatccgaaaagtaagggcgtcagttaattgaaaagcagattttaagtcttaatttgtttcttata |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47635715 |
gagcatggaagaagaagcatgactctgcagcacaagatcctaaaagtaagggcgtcagttaattgaaaagcagattttaagtcttaatttgtttcttata |
47635814 |
T |
 |
| Q |
301 |
tgcataatctgctgtcataagttgatcttata |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47635815 |
tgcataatctgctgtcataagttgatcttata |
47635846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University