View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17457_high_7 (Length: 304)
Name: NF17457_high_7
Description: NF17457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17457_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 4292727 - 4292430
Alignment:
| Q |
1 |
tttacaaacaagcttgcctatgctcctctagttggttcagctgctctgagacttctagtccttttttcttgcactgccttgcaataaggacacttcatgg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
4292727 |
tttacaaacaggcttgcctatgctcctctggttggttcagctgctctgagacttctggtccttttttcttgcattgccttccaataatgacacttcatgg |
4292628 |
T |
 |
| Q |
101 |
gttactagtaataatattttgcttcttggatcttgtagtaattctgtcagagttgttgccagcctgatttttagggctcttatgctttttcgattttctg |
200 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
4292627 |
gttaacagtagtaatattttgcttcttggatcttgtagtaattatgttagagttgttgccagcctgattttttgggctcttatgctttttcgatttcctg |
4292528 |
T |
 |
| Q |
201 |
ccacacttaatagagctagccaaaatagtttgagtatccagacattgctcaacatctttgtacctccgcatgctatccatatgttttttagtgtctgt |
298 |
Q |
| |
|
||| |||||||| ||||| || ||| ||||||||||||||||||||| ||| ||| | ||| ||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
4292527 |
ccagacttaatatagctaacccaaacagtttgagtatccagacattgttcagcatatgtgtgcctatgcaagctatccatatgtttcttagtgtctgt |
4292430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University