View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17457_low_10 (Length: 229)
Name: NF17457_low_10
Description: NF17457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17457_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 21 - 180
Target Start/End: Original strand, 6667272 - 6667430
Alignment:
| Q |
21 |
gttacaaaaggacttgattaaaataaaaataaattaaaccatattaattggcttactcggttgccttttacaaaattttaaattaacaaccacctgaaac |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| || |
|
|
| T |
6667272 |
gttacaaaaggacttgattaaaataaaaataaattaaaccatattaattggcttactcggttgccttttgcaaaattttaaattaacatccacctg-gac |
6667370 |
T |
 |
| Q |
121 |
caatggcagcgaaggtgtccaagggagagtgttaaagcaactgtgcttagcattcctctt |
180 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
6667371 |
caatggcaacgaagatgtccaagggagagtgttaaagcaactgttcttaacattcttctt |
6667430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 77 - 178
Target Start/End: Complemental strand, 32135869 - 32135769
Alignment:
| Q |
77 |
tcggttgccttttacaaaattttaaattaacaaccacctgaaaccaatggcagcgaaggtgtccaagggagagtgttaaagcaactgtgcttagcattcc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32135869 |
tcggttgccttttacaaaattttaaattaacaaccacctgga-ccaatggcagcggaggtgtccaagggagagtgttaaagcaaccatgcttagcattcc |
32135771 |
T |
 |
| Q |
177 |
tc |
178 |
Q |
| |
|
|| |
|
|
| T |
32135770 |
tc |
32135769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University