View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17457_low_8 (Length: 298)
Name: NF17457_low_8
Description: NF17457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17457_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 282
Target Start/End: Original strand, 4292704 - 4292977
Alignment:
| Q |
9 |
agcataggcaagcttgtttgtaaaagtatcacccgcagaagagttccattttaaagtgtcaggatgacaatcagcagatgccgatgcgtgctagcaggaa |
108 |
Q |
| |
|
||||||||||||| ||||||||||| || ||||| || ||||||| |||||||| |||||||| | |||||||||||||| ||||| |||||||||||| |
|
|
| T |
4292704 |
agcataggcaagcctgtttgtaaaattaccacccacataagagtttcattttaaggtgtcagggtcacaatcagcagatgttgatgcatgctagcaggaa |
4292803 |
T |
|
| Q |
109 |
tatggagcagctccactatataggcctatcaggccaagtgtcagtacagaagaacaccacttctccacatacttttgttttgccattccttgatagagat |
208 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4292804 |
tgtggagcagctccactatataggcctatcaggccaagtgtcagtacagaagaacaccacttctctacatacttttgttttgcctttccttgatagagat |
4292903 |
T |
|
| Q |
209 |
aggctagttttattgtttagctagggaattgaagtaagttgcagtagaatagatggcttgccatctatgcttct |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||| |
|
|
| T |
4292904 |
aggctagttttattgtttagctagggaattgaagtaagtggaagtagaaaagatggcttgccatctatgcttct |
4292977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University