View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17458_high_12 (Length: 238)
Name: NF17458_high_12
Description: NF17458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17458_high_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 5252182 - 5252404
Alignment:
| Q |
19 |
tggtcacataatcgtgcttcactatccaaccctttttctatatat---ctatctttcaacccatacttctggaagatttccttgaagtgtttgtaaaata |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5252182 |
tggtcacataatcgtgcttcactatccaaccctttttctatatatgatctatctttcaacccatacttctggaagatttccttgaagtgtttgtaaaata |
5252281 |
T |
 |
| Q |
116 |
taaatcattcatagacatgacaatacattcttcaccttcactatcatatatagtgtcatattcaattcaagacaagatatataaatacgtgacttagctt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5252282 |
taaatcattcatagacatgacaatacattcttcaccttcactatcatatatagtgtcatattcaattcaagacaagatatataaatacgtgacttagctt |
5252381 |
T |
 |
| Q |
216 |
gttggggaggaaggttttttccc |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5252382 |
gttggggaggaaggttttttccc |
5252404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University