View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17458_high_14 (Length: 227)
Name: NF17458_high_14
Description: NF17458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17458_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2116208 - 2115988
Alignment:
| Q |
1 |
ccttgcagcaaataatggtacctttgaaagacctatataccctaccctatgaatttatttttgacctacataaaaattagaggaaattttcttttattag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
2116208 |
ccttgcagcaaataatggtacctttgaaagacctatataccctaccctatgaatttatttttgacctacataaaaattagaggaagtttttttttattag |
2116109 |
T |
|
| Q |
101 |
gtgtaaactagcggcgcattatgcatcaaccacttgcgctagacctagtaattcattagaggttattgctaattactaattaaaagaaacagattttgct |
200 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2116108 |
gtgtaaactaccggcacattatgcatcaaccacttgcaccagacctagtaattcattagaggttattgctaattactaatt-aaagaaacagattttgct |
2116010 |
T |
|
| Q |
201 |
tagagcaatctttgaggaggtt |
222 |
Q |
| |
|
|| ||| ||||||||||||||| |
|
|
| T |
2116009 |
taaagcgatctttgaggaggtt |
2115988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University