View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17461_high_6 (Length: 322)
Name: NF17461_high_6
Description: NF17461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17461_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 8188411 - 8188098
Alignment:
| Q |
1 |
tcatcatcaaggttttcattttcatgagatgaaagaccgtcacgttctccaccctgtaacacagctgctagaaattttttatactcttcttcatcatcga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188411 |
tcatcatcaaggttttcattttcatgagatgaaagaccgtcacgttctccaccctgtaatacagctgctagaaattttttatactcttcttcatcatcga |
8188312 |
T |
|
| Q |
101 |
cattttgaacatcatcttcatcatcggtctcttgaagaaaggtctcaagctcatcaagactgaaaccttcaagcgaataacgagctctagtacgcataca |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188311 |
cattttgaacatcatcttcatcatcagtctcttgaagaaaggtctcaagctcatcaagactgaaaccttcaagcgaataacgagctctagtacgcataca |
8188212 |
T |
|
| Q |
201 |
aatagcatcctcagtatctatgtctatcactgggcttcggggtttcgttgtgttgcttatgtcttctatcctaaaaccatcactagtaccactaatcaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8188211 |
aatagcatcctcagtatctatgtctatcactgggcttcggggtttcgttgtgttgcttatgtcttctatcctaaaaccatcactagtaccactaatcaag |
8188112 |
T |
|
| Q |
301 |
tcattcttcttctc |
314 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8188111 |
tcattcttcttctc |
8188098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University