View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17462_high_17 (Length: 216)
Name: NF17462_high_17
Description: NF17462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17462_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 6496930 - 6497127
Alignment:
| Q |
1 |
caattgatgactatatctttatgtgttacatacatgaagatgaaacatgctcatgtat-ttacatgaatatgactgaaattaatccaacaactaccgagg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6496930 |
caattgatgactatatctttatgtgttacatacatgaagatgaaacatgctcatgtatattacatgaatatgactgaaattaatccaacaactaccgagg |
6497029 |
T |
|
| Q |
100 |
atacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatcttgaaggtttctgctatccatatgaaatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6497030 |
atacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatcttgaaggtttctgctatccatatgaaatg |
6497127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 95 - 172
Target Start/End: Original strand, 6514384 - 6514461
Alignment:
| Q |
95 |
cgaggatacagctctgtatttgaagacccattgactgattcttgagctgaactatgaccccatgatttcatatcttga |
172 |
Q |
| |
|
|||||| | |||| ||||||||||| ||||||||||||||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
6514384 |
cgaggaaatagctgtgtatttgaagccccattgactgattcttgagcagaactatgacctgacgatttcatatcttga |
6514461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University