View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17462_low_12 (Length: 296)
Name: NF17462_low_12
Description: NF17462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17462_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 8014391 - 8014104
Alignment:
| Q |
1 |
gtagggataggagtaaagttaaggggtatgaaataaaattttctcaaaatagagagaaaaaagttctacacaaagtgaagtccacacatatgaggcccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8014391 |
gtagggataggagtaaagttaaggggtatgaaataaaattttctcaaaatagagagaaaaaagttctacacaaagtgaagtccacacatatgaggcccat |
8014292 |
T |
|
| Q |
101 |
gtccaacaggacaagaaagcagcccactccattccacaaccctgaaatctgaatgaaatgcatctttcaacaagattgtttttcctttcaaatgctatca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8014291 |
gtccaacaggacaagaaagcagcccactccattccacaaccctgaaatctgaatgaaatgcagctttcaacaagattgtctttcctttcaaatgctatca |
8014192 |
T |
|
| Q |
201 |
tgtgatcatgt--------attataattgatcatatgatctacatgaacacgaaaacaaagttatggagcagctctagggtctttttg |
280 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8014191 |
tgtggtcatgtacgaatcgattataattgatcatatgatctacatgaacacgaaaacaaagttatggagcagctctagggtctttttg |
8014104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University