View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17462_low_17 (Length: 236)
Name: NF17462_low_17
Description: NF17462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17462_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 221
Target Start/End: Complemental strand, 9807076 - 9806867
Alignment:
| Q |
12 |
cagagattagggagttccaagacttactcacacacttcatccgtatcagatatttaacctgaaggaaggaaagcaatacagcgatgagttcttcggggag |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9807076 |
cagagattagggagttccaagacttactcacacacttcatccgtatcagatatttaacctgaaggaaggaaagcaatacagcgatgagttcttcggggag |
9806977 |
T |
 |
| Q |
112 |
aaataccggcgatggagactgagtattcatcgttttggtccctgatggagactgagttcttcttctttggattgctttcttttgcatggggttcgggtgg |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9806976 |
aaataccggcgatggagacggagtattcatggttttggtccctgatggagactgagttcttcttctttggattgctttcttttgcatggtgttcgggtgg |
9806877 |
T |
 |
| Q |
212 |
cggttgtttg |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
9806876 |
cggttgtttg |
9806867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University