View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17462_low_19 (Length: 230)
Name: NF17462_low_19
Description: NF17462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17462_low_19 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 55 - 214
Target Start/End: Complemental strand, 1217506 - 1217343
Alignment:
| Q |
55 |
ataggccaccaccgttcttgattagtctgttttcagaataaataggaattctatcataatgatcaccaccactcgtcatgacaggcattaataactccct |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1217506 |
ataggccaccaccgttcttgattagtctgttttcagaataaataggaattctatcataatgatcaccaccactcgtcatgacaggcattaataactccct |
1217407 |
T |
 |
| Q |
155 |
aaaaatattgtcataaaa----atattaccccatcaccagatatattagccacttggacaataa |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1217406 |
aaaaatattgtcataaaaatatatattaccccatcaccagatatatcagccacttggacaataa |
1217343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University