View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_high_20 (Length: 311)
Name: NF17464_high_20
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 195 - 297
Target Start/End: Complemental strand, 7239324 - 7239216
Alignment:
| Q |
195 |
gtcttgttacatgtctagaacacattttttaaaagt-----tttcggatcattctttaaagttctaaaacacattccgaggtttgtctccatttaaa-ta |
288 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
7239324 |
gtcttgttacatgtctagaacacattctttaaaagtcttgttttcggatcattctttaaagttctaaaacacattccgaaatttgtctccatttaaatta |
7239225 |
T |
 |
| Q |
289 |
ataaataat |
297 |
Q |
| |
|
||||||||| |
|
|
| T |
7239224 |
ataaataat |
7239216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University