View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_high_38 (Length: 243)
Name: NF17464_high_38
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_high_38 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 40442482 - 40442256
Alignment:
| Q |
17 |
gaacaacagatactaacagaaaagcaacaccctcaagcatgggcacatggtatttatggaattagaagccaagctatcttctcatttgaaaaattagcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40442482 |
gaacaacagatactaacagaaaagcaacaccctcaagcatgggcacatggtatttatggaattagaagccaagctatcttctcatttgaaaaattagcaa |
40442383 |
T |
|
| Q |
117 |
gtctatatagatattgttttcatggcttaggataagaggaacaatttcaatgaacatgtatggacatagaaaagtaatcagtgcctcaatctcaaggatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40442382 |
gtctatatagatattgttttcatggcttaggataagaggaacaatttcaatgaacatgtatggacatagaaaagtaatcagtgcctcaatcacaaggatg |
40442283 |
T |
|
| Q |
217 |
tccaaaatattgatcaagttggtaaaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
40442282 |
tccaaaatattgatcaagttggtaaaa |
40442256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 40 - 100
Target Start/End: Original strand, 13063631 - 13063691
Alignment:
| Q |
40 |
gcaacaccctcaagcatgggcacatggtatttatggaattagaagccaagctatcttctca |
100 |
Q |
| |
|
|||| |||||||||||| |||| |||| ||| ||||||||||||||||||||| ||||| |
|
|
| T |
13063631 |
gcaataccctcaagcattggcatttggtgtttcaggaattagaagccaagctatcatctca |
13063691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University