View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_high_39 (Length: 243)
Name: NF17464_high_39
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_high_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 44575438 - 44575197
Alignment:
| Q |
1 |
tttatgagtgtatctaccttcctataatgaggataatcaataaaagggctacaagaagaatgagcatgggatgcagaatcagaattgggatattattatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575438 |
tttatgagtgtatctaccttcctataatgaggataatcaataaaagggctacaagaagaatgagcatgggatgcagaatcagaattgggatattattatc |
44575339 |
T |
|
| Q |
101 |
tatcctatgcatgttggtagctgcagttattgagaaaaagcgtcgtgactcggctttgaaacacaattcgtttatttcgcctgtgagctttggtttgctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575338 |
tatcctatgcatgttggtagctgcagttgttgagaaaaagcgtcgtgactcggctttgaaacacaattcgtttatttcgcctgtgagctttggtttgctc |
44575239 |
T |
|
| Q |
201 |
ttgccgcagtttgcgctgtccggtttaaatgaagcctttgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575238 |
ttgccgcagtttgcgctgtccggtttaaatgaagcctttgct |
44575197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University