View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_low_29 (Length: 295)
Name: NF17464_low_29
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 51 - 290
Target Start/End: Original strand, 22294769 - 22295008
Alignment:
| Q |
51 |
gtgcaatatctatggcaaatgcaaagttatcaacagtagaatctgtgactgcccttgtctgcatgtctgtctctcatctgcagtcactgaatactcttga |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22294769 |
gtgcaatatctatggcaaatgcaaagttatcaacagtagaatctgtgactgcccttgtctgcatgtctgtctctcatctgcagtcactgaatactcttga |
22294868 |
T |
 |
| Q |
151 |
ctaccgtccttaaccttcgtcactctctcactctcactatcacatgaaaaataaagtatcatctaaaagaaaacctcctttattttcataacactgccac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22294869 |
ctaccgtccttaaccttcgtcactctctcactctcactatcacatgaaaaataaagtatcatctaaaagaaaacctcctttattttcataacactgccac |
22294968 |
T |
 |
| Q |
251 |
ttcttgcatttaatgcaagaaccttagctttcatctcact |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22294969 |
ttcttgcatttaatgcaagaaccttagctttcatttcact |
22295008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University