View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_low_34 (Length: 267)
Name: NF17464_low_34
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 19056386 - 19056137
Alignment:
| Q |
1 |
attaaacttgcagaagtcaagaaccctattattattaatcaaaactacaatcctcatatatatgatagttctagcgaagtagtgaaagtgagtgatgtta |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19056386 |
attaaacttgtagaagtcaagaaccctattattattaatcaaaactacaatcctcatatatatgatagttctagcgaagtagtgaaagtgagtgatgtta |
19056287 |
T |
 |
| Q |
101 |
ctttcctcaacatacatggaacctccgttaatgagaatacggtccaattaaattgtgaccctaatattgggtgcgacaacattataatcgatcatattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19056286 |
ctttcctcaacatacatggaacctccgttaatgagaatacggtccaattaaattgtgaccctaaaattgggtgcgacaacattataatcgatcatattaa |
19056187 |
T |
 |
| Q |
201 |
cataactagtgttgctggaggggaaccacatgcatcatgcactaatgcac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19056186 |
cataactagtgttgctggaggggaaccacatgcatcatgcactaatgcac |
19056137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 81 - 125
Target Start/End: Original strand, 21552048 - 21552092
Alignment:
| Q |
81 |
agtgaaagtgagtgatgttactttcctcaacatacatggaacctc |
125 |
Q |
| |
|
|||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
21552048 |
agtggaagtaagtgatgttactttcagcaacatacatggaacctc |
21552092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University