View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_low_37 (Length: 251)
Name: NF17464_low_37
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 4284466 - 4284245
Alignment:
| Q |
11 |
cacagacgctacgctctaatagaaggagcgtgaagtaaaagggttttggagtttccagattaggataaaagcaagatgcagcggtttaaccggttatgca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284466 |
cacagacgctacgctctaatagaaggagcgtgaagtaaaagggttttggagtttccagattaggataaaagcaagatgcagcggtttaaccggttatgca |
4284367 |
T |
|
| Q |
111 |
gtgaatggtaccccgttatgtccgggttattcaactaagggtagggtagggcccacagttcacaaccacatagttggagggtagtagtaagtagggtact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4284366 |
gtgaatggtaccccgttatgtccgggttattcaactaagggtagggtagggcccacagttcacaaccacatagttggagggtagtagtaagtagggtact |
4284267 |
T |
|
| Q |
211 |
gtacttcactgactgagcccta |
232 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4284266 |
atacttcactgactgagcccta |
4284245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University