View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_low_41 (Length: 245)
Name: NF17464_low_41
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 230
Target Start/End: Original strand, 14924931 - 14925150
Alignment:
| Q |
11 |
cacagatttgggttgtagagtcagcctcttgcaaatgcaggcttcttgcattatatttgtaatgagtctcgtgtctcttaatttgtaacaataaattggt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14924931 |
cacagatttgggttgtagagtcagcctcttgcaaatgcatgcttcttgcattatatttgtaatgagtctcgtgtctcttaatttgtaacaataaattggt |
14925030 |
T |
 |
| Q |
111 |
gtgtttctagcatgttaccacatgatttattattatgcacacttcatattcaacttcttagcttccctgagcttctttctaatattataaatctgctaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
14925031 |
gtgtttctagcatgttaccacatgatttattatcatgcacacttcatattcaacttcttagcttcccttagcttctttctaatattataaatatgctaca |
14925130 |
T |
 |
| Q |
211 |
ttgccgtttgcggttagatt |
230 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
14925131 |
ttgccgtttgtggttagatt |
14925150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University