View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_low_46 (Length: 236)
Name: NF17464_low_46
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 8056807 - 8056692
Alignment:
| Q |
1 |
aactttagtttgacacttggtgttgtgttactagctgacaatttgggagagacaatgattccatatctgaaagtagtttcctacaatgcttcttgtttca |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8056807 |
aactttagtt-gacacttggtgttgtgttactagctgacaatttgggagagacaatgattccatatctgaaagtagtttcctacaatgcttcttgtttca |
8056709 |
T |
 |
| Q |
101 |
taaaatttaattattac |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8056708 |
taaaatttaattattac |
8056692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 151 - 228
Target Start/End: Complemental strand, 8056658 - 8056581
Alignment:
| Q |
151 |
actagtgaaattatttgtaaaaggaagtaacattgctattgcttcctttgattcggttgatcaatgatcatgatgatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8056658 |
actagtgaaattatttgtaaaaggaagtaacattgctattgcttcctttgattcggttgatcaatgatcatgatgatg |
8056581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University