View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17464_low_51 (Length: 202)
Name: NF17464_low_51
Description: NF17464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17464_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 20 - 93
Target Start/End: Original strand, 56068802 - 56068879
Alignment:
| Q |
20 |
gtaggcactaggcagggtaatgcattatctgaagtccttgcttaaatgaaata----gtgtaggacaagagcattcaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56068802 |
gtaggcactaggcagggtaatgcattatctgaaggccttgcttaaatgaaatagtacgtgtaggacaagagcattcaa |
56068879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 122 - 170
Target Start/End: Original strand, 56069024 - 56069072
Alignment:
| Q |
122 |
aaatgaaatagtgtatgacatgacattgtagagaagagacaaggatgat |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56069024 |
aaatgaaatagtgtatgacatgacattgtagagaagagacaaggatgat |
56069072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University