View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17465_high_10 (Length: 247)
Name: NF17465_high_10
Description: NF17465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17465_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 18984061 - 18983831
Alignment:
| Q |
1 |
tgcatttgcacgtccaaaattaattgtagatcatacatgcaatgtaagtgattacatgttcatccaacataaattgcagatgcagtttcagttgatttga |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18984061 |
tgcatttgcatgtccaaaattaattgtagatcatacatgcaatgtaagtgattacatgttcatccaacataaattgcagatgcagtttcagttgatttga |
18983962 |
T |
 |
| Q |
101 |
cctactaagaattttatgagtactttcatcgaaaaaatatagagaaaattcactagcatgagttgcactctatgacctattgacttctaggtcaagccac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18983961 |
cctactaagaattttatgagtactttcatcggaaaaatatacaaaaaattcactagcatgagttgcactctatgacctattgacttctaggtcaagccac |
18983862 |
T |
 |
| Q |
201 |
atgcagtagccactttataacatgtaatttc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18983861 |
atgcagtagccactttataacatgtaatttc |
18983831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University