View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17465_low_10 (Length: 252)
Name: NF17465_low_10
Description: NF17465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17465_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 30292629 - 30292863
Alignment:
| Q |
1 |
tatgtaaagtaatttactaaagttatgaaattctctagttttaaaatataattttgtggttaaaaaagaagcacacataaataccnnnnnnnatctgcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30292629 |
tatgtaaagtaatttactaaagttatgaaattctctagttttaaaatataattttgtggttaaaaaagaagcacacataaatacctttttttatctgcaa |
30292728 |
T |
|
| Q |
101 |
aaatttattaaaaccctcttatcaaagcacaagatgaatccaagataagagaaaagacaagacaggccatagaaatacaactgcagtacagaaatcaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30292729 |
aaatttattaaaaccctcttatcaaagcacaagatgaatccaagataagagaaaagacaagacaggccatagaaatacaactgcagtacagaaatcaata |
30292828 |
T |
|
| Q |
201 |
caggccaaaggaacaacaacaatccaccacttggt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30292829 |
caggccaaaggaacaacaacaatccaccacttggt |
30292863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University