View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17466_high_3 (Length: 388)
Name: NF17466_high_3
Description: NF17466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17466_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 345; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 20 - 380
Target Start/End: Complemental strand, 39586821 - 39586461
Alignment:
| Q |
20 |
ctagcgacggttttgcgagagtggagttaaaaacaaagctttcggagatgacttttaacacgataatgagaatgatatctggaaagagatattatggtga |
119 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586821 |
ctagcgacggttttgtgagagtggagttgaaaacaaagctttcggagatgacttttaacacgataatgagaatgatatctggaaagagatattatggtga |
39586722 |
T |
 |
| Q |
120 |
ggattgtgatgtgagtgatgaagaagaagctaagggatttagggagatgattaaggagatggtatcgttgggtggttcgagtaatcctggtgaatttgtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586721 |
ggattgtgatgtgagtgatgaagaagaagctaagggatttagggagatgattaaggagatggtatcgttgggtggttcgagtaatcctggtgaatttgtt |
39586622 |
T |
 |
| Q |
220 |
gggattttgaggtggttcgattttggtggttatgaaaagaagttgaaaaggattgcaagaagatttgatgggtttttgcagggtttgattgatgagcata |
319 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39586621 |
gggattttgaggtggtttgattttggtggttatgaaaagaagttgaaaaggattgcaagaagatttgatgggtttttgcaaggtttgattgatgagcata |
39586522 |
T |
 |
| Q |
320 |
ggaggaagaaggagaaggggaataacatgattgatcatctcttgaacttgcaagaattatc |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586521 |
ggaggaagaaggagaaggggaataacatgattgatcatctcttgaacttgcaagaattatc |
39586461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 85 - 125
Target Start/End: Original strand, 38954399 - 38954439
Alignment:
| Q |
85 |
atgagaatgatatctggaaagagatattatggtgaggattg |
125 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
38954399 |
atgagaatgatctctggaaagagatactatggtgatgattg |
38954439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 59 - 139
Target Start/End: Original strand, 5884330 - 5884410
Alignment:
| Q |
59 |
tttcggagatgacttttaacacgataatgagaatgatatctggaaagagatattatggtgaggattgtgatgtgagtgatg |
139 |
Q |
| |
|
||||||| ||||| ||||| || |||||||||||| | || || || ||||| ||||| | ||||||||||||||||||| |
|
|
| T |
5884330 |
tttcggaaatgacatttaatactataatgagaatggtgtcggggaaaagatactatggaaatgattgtgatgtgagtgatg |
5884410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University