View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17468_high_31 (Length: 239)
Name: NF17468_high_31
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17468_high_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 4706872 - 4707077
Alignment:
| Q |
17 |
caaaggatctgaaaaggaaactaggatatgatgataatgttgcaatagctacatgtgggacactctatgatgctcaaaatatggtgaggggtaaattcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4706872 |
caaaggatctgaaaaggaaactaggatatgatgataatgttgcaatagctacatgtgggacaatctatgatgctcaaaatatggtgtggggtaaattcat |
4706971 |
T |
|
| Q |
117 |
tcattctgttacaggatctaatagtcgtcctcttaaaggtgtatggatcgtgccgagagatcataaacaccaagatcaaatatggtaacttgttggggtc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4706972 |
tcattctgttacaggatctaatagtcgtcctcttaaaggtgtatggatcgtgccgagagatcataaacaccaagatcaaatatggtaacttgttggggtc |
4707071 |
T |
|
| Q |
217 |
atattt |
222 |
Q |
| |
|
|||||| |
|
|
| T |
4707072 |
atattt |
4707077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 70 - 222
Target Start/End: Original strand, 4702874 - 4703026
Alignment:
| Q |
70 |
tgtgggacactctatgatgctcaaaatatggtgaggggtaaattcattcattctgttacaggatctaatagtcgtcctcttaaaggtgtatggatcgtgc |
169 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| ||||| ||| ||||| || |||||| || | | ||||| |||||||| ||||||||| ||| |
|
|
| T |
4702874 |
tgtgggacactctatgatgcaaaaaatttggtgtggggtcaatacattcggtcagttacattatttgaacatcgtctccttaaaggagtatggatcctgc |
4702973 |
T |
|
| Q |
170 |
cgagagatcataaacaccaagatcaaatatggtaacttgttggggtcatattt |
222 |
Q |
| |
|
| ||| ||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4702974 |
caagatatcataaacactaagatcaaagatggtaacttgttggggtcatattt |
4703026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University