View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17468_high_35 (Length: 228)
Name: NF17468_high_35
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17468_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 13 - 114
Target Start/End: Complemental strand, 36744019 - 36743923
Alignment:
| Q |
13 |
ataattctcgcaagtctttctttgatagaagcaagcatattagaacttggtgtctattattagaagaatgacaagtctcatgagatttcgccactttatc |
112 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
36744019 |
ataattctcgcaagtctt-----gatagaagcaagcatattagaacttggtgtctattattagaagaatgacaagtctgatgagatttcgccacgttatc |
36743925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 172 - 214
Target Start/End: Complemental strand, 36743506 - 36743464
Alignment:
| Q |
172 |
atgaatttgaaaatcaaatccaaacaaattaatcaaacttttt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36743506 |
atgaatttgaaaatcaaatccaaacaaattaatcaaacatttt |
36743464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University