View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17468_high_36 (Length: 213)
Name: NF17468_high_36
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17468_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 37950638 - 37950838
Alignment:
| Q |
1 |
gttgtagaaggtcatttgcagaggtctaccggtggatccttattttttggatccatatcagggctccccttttacaagtatgaggatgaggataagttga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
37950638 |
gttgtagaaggtcatttgcataggtctaccggtggatccttattttttggatccatatcagggctccccttttacaagcatgaggatgaggacaagttga |
37950737 |
T |
 |
| Q |
101 |
gttgagtggctcacgatgttctactgtttcttcttcttgacatccaaaaccgtaaatgacaattgtgtgggtctttgttgagggtttatggtggtggatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37950738 |
gttgagtggctcacgatgttctactgtttcttcttctcgacatccaaaaccgtaaatgacaattgtgtgggtctttgttgagggtttatggtggtggatg |
37950837 |
T |
 |
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
37950838 |
a |
37950838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 58
Target Start/End: Complemental strand, 10766249 - 10766193
Alignment:
| Q |
2 |
ttgtagaaggtcatttgcagaggtctaccggtggatccttattttttggatccatat |
58 |
Q |
| |
|
||||||||||||||||||| ||||| ||| | || ||||||||||||| ||||||| |
|
|
| T |
10766249 |
ttgtagaaggtcatttgcataggtccaccaatagacccttattttttggttccatat |
10766193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University