View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17468_low_25 (Length: 272)
Name: NF17468_low_25
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17468_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 256
Target Start/End: Complemental strand, 4394177 - 4393932
Alignment:
| Q |
11 |
ataggggatggaacagtgatggtggaggaagtagtaggatgtaaaacagtagtagtagttgtggcgggtggcaaacagatgttcagatgtggggggattt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4394177 |
ataggggatggaacagtgatggtggaggaagtagtaggatgtaaaacagtagtagtagttgtggcgggtggcaaacagatgttcagatgtggggggattt |
4394078 |
T |
 |
| Q |
111 |
ggtgcattattttcacggacttatcctgttcttgatctttctttgaggaattaacaccatggttgttcatgatctcactaagcaggaaactggtagtgca |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4394077 |
ggtgcattattttcacagacttatcctgttcttgatctttctttgaggaattaacaccatggttgttcatgatctcactaagcaggaaactggtagtgca |
4393978 |
T |
 |
| Q |
211 |
attaccagtgttatggtgttgctgaccatgtgattgagcaggaacc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4393977 |
attaccagtgttatggtgttgctgaccatgtgattgagcaggaacc |
4393932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University