View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17468_low_30 (Length: 241)
Name: NF17468_low_30
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17468_low_30 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 3 - 241
Target Start/End: Complemental strand, 280271 - 280033
Alignment:
| Q |
3 |
aaatgaatgtccacttcattaactgaaattacaatctctatgtatcccctaaatcatacctaagtttgatttttctgactaactttccaattaacatttg |
102 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
280271 |
aaatggatgtccacttcattaactgaaattacaatctctatgtatcccttaaatcatacctaagtttgatttttctgactaactttccaattaacatttg |
280172 |
T |
|
| Q |
103 |
tccattggaagttcatgaagccaccatctctggtgacacctcaaccgccgctgccaaaaacgcttgcgcaaatattagcgaacactttcgatgtaccaac |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
280171 |
tccattggaagttcatgaagccaccatctctggtgacacctcaaccgccgctgagaaaaacgtttgcgcaaatattagcaaacactttcgatgtaccaac |
280072 |
T |
|
| Q |
203 |
tagccaactaaacgatacatcaggggtgagcattcaagt |
241 |
Q |
| |
|
|||||||||||||||| ||| | |||||||||||||||| |
|
|
| T |
280071 |
tagccaactaaacgatgcattaagggtgagcattcaagt |
280033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 3 - 61
Target Start/End: Complemental strand, 265854 - 265796
Alignment:
| Q |
3 |
aaatgaatgtccacttcattaactgaaattacaatctctatgtatcccctaaatcatac |
61 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||| |||| |||| |||| |
|
|
| T |
265854 |
aaatgaatgttcacttcattaactgaaattacaatctctctgtaccccccaaattatac |
265796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University