View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17468_low_35 (Length: 235)
Name: NF17468_low_35
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17468_low_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 35449846 - 35449625
Alignment:
| Q |
1 |
tttttcttgtgcttcatctctttctctaatgatgttgttgattagatctttaaggttcattagttgttcatcnnnnnnngtgagctcttcttgtgctgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
35449846 |
tttttcttgtgcttcatctctttctctaatgatgttgttgattagatctttaaggttcattagttgttcatctttttttgtgagttcttcttgtgctgtt |
35449747 |
T |
|
| Q |
101 |
actcttgtttgttcaagctctaaagttgtgtatagaagtgattgtctcaaatcctccattgactgcataacaattaagaatcattagtactcaaattgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35449746 |
actcttgtttgttcaagctctaaagttgtgtatagaagtgattgtctcaaatcctccattgactgcataacaattaagaatcattagtactcaaattgca |
35449647 |
T |
|
| Q |
201 |
aaaaacatgtaagtaaagttat |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35449646 |
aaaaacatgtaagtaaagttat |
35449625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University