View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17468_low_39 (Length: 204)
Name: NF17468_low_39
Description: NF17468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17468_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 15 - 187
Target Start/End: Original strand, 1152753 - 1152927
Alignment:
| Q |
15 |
cacagacacacaatcacacgattccattgtgtgaatttcaaagcaacaacgtaatcgtgttttttatt--taataataaccctaaagcctccgttttgcg |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
1152753 |
cacacacacacaatcacacgattccattgtgtgaatttcaaagcaacaacgtaatcgtgtttttttttattaataataaccctaaagcctccgttttgcg |
1152852 |
T |
 |
| Q |
113 |
gttacaagcaactaagagttacgtttcttcaacatcttttatactaacgacaaacccattaaactatataactct |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1152853 |
gttacaagcaactaagagttacgtttcttcaacatcttttatactaacgacaaacccattaaactatataactct |
1152927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University