View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17469_high_14 (Length: 320)
Name: NF17469_high_14
Description: NF17469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17469_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 18 - 305
Target Start/End: Original strand, 488290 - 488577
Alignment:
| Q |
18 |
attctcaaatcccaaatctcaccatggcttcaccacttcgccgaagaagaattccagctcccaaaaaacaatccacgaccttcaacaacaacgacgacga |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488290 |
attctcaaatcccaaatctcaccatggtttcaccacttcgccgaagaagaattccagctcccaaaaaacaatccacgaccttcaacaacaacgacgacga |
488389 |
T |
 |
| Q |
118 |
cgtagtttgccagaaatgcaactccggcaaatccccaactaagttgcttctctgcgacaattgcgacaacggctatcatctcttctgcctcactcctatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488390 |
cgtagtttgccagaaatgcaactccggcaaatccccaactaagttgcttctctgcgacaattgcgacaacggctatcatctcttctgcctcactcctatc |
488489 |
T |
 |
| Q |
218 |
ctcccttccgtccctaaatcctcttggttttgcccctcctgctctcacaatcccaaaatccccaaatgtatgcatcttttcatttcat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
488490 |
ctcccttccgtccctaaatcctcttggttttgcccctcctgctctcacaatcccaaaatccccaaatgtatgcatcttttcatttcat |
488577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 113 - 207
Target Start/End: Original strand, 500482 - 500576
Alignment:
| Q |
113 |
gacgacgtagtttgccagaaatgcaactccggcaaatccccaactaagttgcttctctgcgacaattgcgacaacggctatcatctcttctgcct |
207 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
500482 |
gacgacattgtttgccagaaatgcaactccggcaaatccccaaccaagttgcttctttgcgacaattgcaacaaaggctaccatctcttctgcct |
500576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 267
Target Start/End: Original strand, 500579 - 500624
Alignment:
| Q |
222 |
cttccgtccctaaatcctcttggttttgcccctcctgctctcacaa |
267 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
500579 |
cttccgtcccgaaatcctcgtggttttgcccctcttgctcccacaa |
500624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University